This transition was characterized further by fluorescence, following chemical ligation of an environmentally sensitive diethylaminocoumarin fluorophore to a cysteine, introduced at specific locations by site-directed mutagenesis.
Using tryptophan as an optical probe placed at strategic locations through site-directed mutagenesis, we studied two binding sites, one (F146W) near the DNA backbone in the thumb D subdomain and the other (S229W) at the DNA minor groove in the palm C subdomain, and the active site (Y271W) in the finger N subdomain.
Images for the FadD13 model and the docking studies were prepared by using Pymol [58] whereas the images showing the active site and location of residues selected for mutagenesis were generated by using CastP [34] and VMD [59], respectively.
For a list of the mutagenesis primers and location of polymorphisms, see Supporting Information, Table S1.
A 1.1-kb fragment of DNA encoding kanamycin resistance (Kanr) was inserted by in vitro transposon mutagenesis at a random location on pSP70 to construct pSP70-Kanr that conferred Kanr to the host E. coli strain.
Thus, even though the proposed peptide-binding site lies on the edge of the lectin site, in an area where carbohydrate-binding also occurs, this location is fully compatible with previous mutagenesis data.
A DraI restriction site was incorporated into GAD67/blunt and GAD67Tyr292Phe_65loop_Val444Leu/blunt constructs in the equivalent location to GAD65 using site-directed mutagenesis with the following primers: 5′gatatctttaaattctggctgatgtggaaagc and 3′cagccagaatttaaagatatccacgtcgcggcc.
This can be performed with site-directed mutagenesis, provided that the locations of the glycosites in the polypeptide chain are known.
Au, who has remained the driving force behind the conferences, collaborates with scientists native to each region when organizing the proceedings, and gives priority to locations where the field of environmental mutagenesis is still in the developmental stages.
The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated.
