Your English writing platform
Free sign upExact(2)
Animals were identified by polymerase chain reaction (PCR) using a reverse primer localized inside of aequorin and a sense primer inside the Lox stop: AeGFP.rev: TCAGTTATCTAGATCCGGTGG; LoxSTOP S: CGGGAAAAAGTTAGTTGTGG.
As compared to Wnt8, the Wnt8-KDEL protein tends to be localized inside of the cell (compare Fig. 5A and G, D and J) although the staining was stronger at the cell boundary (Fig. 5G,J).
Similar(58)
Moreover, comparing with localization of chlamydial inclusion membrane protein (IncA2), caspase-9 seemed to localize inside of inclusions.
Here we discovered that hypoxia impaired the formation of nuclear envelope and led prelamin A/C to localize inside of the nuclear lumen, mimicking the nuclear envelope in the HGPS patients.
The transmission electron microscope images showed that individual spherical SWNH particles smaller than 100 nm in diameters were localized inside lysosomes of mice microglia cells.
Moreover, the PA signal detected by a piezoelectric registration was shown[5] to be sensitive both to thermally induced pressures (TIP) of the liquids localized inside the pores of the composite 'porous silicon-liquid' system and to the pressure relaxation phenomena.
Recent study indicated that Al was localized inside the nucleoli of root tip cells of Al sensitive maize [ 21].
CRISP-2 is specifically expressed in the male reproductive tract and localized inside the acrosome of spermatozoa.
In contrast, the hepatocytes that were cultured on the honeycomb film were observed to form a spherical shape, and the actin filaments were localized inside the edge of the spheroid.
Immunoreactivity for Tβ4 appeared focal, mainly localized inside the islets of Langerhans.
ABCA3 is localized inside the limiting membranes of multivesicular bodies in which drugs are efficiently sequestered [ 81– 81].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com