Sentence examples for localized inside a from inspiring English sources
High-speed pressure inducers (aka pinducers) and signal processing are used here to gain insights into the spatial localization of energy dissipation that occurs during ultrasonication, facilitating a design that allows ultrasonication to be spatially localized inside a tube, without requiring that the probe directly contact the solution.
When performing the conventional surgery through the auditory canal, surgeons have to manipulate bones of less than 4 mm high localized inside a maximized 16 × 16 mm cavity size at 34 mm depth.
EM images suggest that both processes occur in ICI treated LCC9 cells; Figure 2 shows autophagosomes forming from mitochondria membranes, while Figure 7B shows an example of classical mitophagy where a mitochondria is localized inside a formed autophagosome.
These RBs were stained in a pattern very similar to that observed in a normal infection, with HSP60 localized inside and PmpD and MOMP on the surface of RBs.
Our immunolabeling study showed that Nmnat3 localizes inside axon nerve fibers, and their dot-like pattern is consistent with a previous demonstration that Nmnat3 locates in mitochondria.
Transmission electron microscopy revealed that the brain stages localize inside axons.
Animals were identified by polymerase chain reaction (PCR) using a reverse primer localized inside of aequorin and a sense primer inside the Lox stop: AeGFP.rev: TCAGTTATCTAGATCCGGTGG; LoxSTOP S: CGGGAAAAAGTTAGTTGTGG.
These antibodies react with (1) a major outer membrane virion glycoprotein(s) gp58-gp130, whose molecular weight varies between strains of cytomegalovirus, (2) a phosphoprotein, pp71, localized inside the virion membrane, (3) a phosphorylated nucleocapsid protein, pp155, and (4) a virion-associated phosphoprotein, pp29.
In contrast, prelamin A/C in LNCaP cells was not only partially localized to the nuclear membrane but also localized inside the nucleus, demonstrating a defect in nuclear envelope formation, similar to that observed in Hutchinson-Gilford Progeria Syndrome.
When Lig4-GFP was expressed alone in the wild-type cells using the P41nmt1 promoter, it mainly localized inside the nucleus, with a higher concentration in the nucleolus, the portion of the nucleus not stained by the DNA binding dye Hoechst 33342.
If GFPuv-hPRR was displayed on the surface of the BmNPV particles, it would be degraded by a less amount of proteinase K than would the VP39 protein, which is a nucleocapsid protein localized inside BmNPV particles.
