Sentence examples for loading template from inspiring English sources

Briefly, the privileged user would prepare a tab-delimited file containing the maps and its localized features, create a bulk loading template and then load the file.

When a privileged user desires to load a set of organisms she can simply create a new bulk loader job using the Drupal content creation interface, select the correct loading template and provide the name of the input file.

The bulk loader loads tab-delimited files using loading templates (not the same as template files).

The load template used in Sect.

Typical per-unit base load curves, chosen from the base load template pool, are shown in Fig. 7a, b.

Regarding the DUC load template, the trends in different seasons and days (weekday or weekend) are different.

The generic Class1 DUC weekday load templates in different seasons are depicted in Fig. 10a.

Based on different load templates, cases are also simulated and analyzed.

So in this section, some other load templates are used and tested based on the proposed active models and strategy to analyze their impacts on the results.

Apart from DUC, there exists another domestic type in the generic ELEXON load profiles, called the Economic 7 (E7) as Class 2. And the winter load templates of Generic profile Class 2-E7, compared with that of DUC, are illustrated in Fig. 10b.

The relative cDNA ratio was calculated using α-tubulin as a reference calibrator to normalize equal loading of template cDNA: 5'andGTCGCGCTGTAAGAAGC3' and 5'TGGTCTTGTCACTTGGCATC3'.