Sentence examples for lines and short from inspiring English sources

Exact(21)

There are several different types of retrotransposons, including long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs).

Theirs is a life of long lines and short, shuttle-like trips, from port to warehouse and back or from port to railhead and back.

Since 1910 the gradual abandonment of competing parallel lines and short lines built by mining and lumbering companies has led to a considerable reduction in Missouri's railroad mileage.

His collection featured proportionate, well-cut pants, rigidly constructed clothes with smooth "trapeze," or trapezoidal, lines, and short skirts, with white midcalf boots and large, dark glasses as accessories.

Arbes [8] has developed differential line protection scheme for the protection of double lines, tapped lines and short lines.

Hence, Pirh2 knockdown myeloma cell lines and short hairpin RNA (shRNA) sequences for targeting Pirh2 mRNA (shPirh, 5′GCACAGACTCCTATGCCATCA3′) and scrambled shRNA oligos (used as a negative control; 5′TTCTCCGAACGTGTCACGT3′) were generated.

Show more...

Similar(39)

Residents would face longer lines and shorter hours at motor vehicle registries, and limited hours at public parks.

Despite expression of the potentially inhibitory KIR ligand HLA class I by osteosarcoma cells, all cell lines and short-term cultures were highly sensitive to lysis by IL-15-activated NK cells (Table  1 and Figs.  1 and 5d).

Accordingly, we find that BRAF and NRAS mutant melanoma cell lines and short-term melanoma cultures show higher levels of miR-146a compared to those that are wild type for these genes.

In addition, vorinostat and cisplatin co-treatment dramatically reduced long-term clonogenic survival compared with either of the drugs alone in both cell lines, and short-term cell viability assays clearly demonstrated strong synergy between the two drugs, with combination indices (CIs) for nearly all dose combinations <1, with many of them falling between 0.3 and 0.7.

The approximately optimal sailing line and short sailing time are obtained using the AC algorithm.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: