Your English writing platform
Discover LudwigExact(1)
"Let's sequence prominent Texans," Dr. Watson said at the press conference in Houston last week.
Similar(59)
The answer to this lies in a closer inspection of the repeated consensus sequences in table 1. Let's take sequence TAAGACCTATGTTAGTAAAG for chromosome 6 which has a double cytosine.
Lest you think I've cherry-picked the single productive period of Sanger's career that did not encompass the famous papers on insulin, RNA, and DNA sequencing, let's instead go back a bit further and consider the 5 years preceding the 1973 phage f1 sequence paper (Sanger et al. 1973).
Now let's consider a sequence of populations with probability distributions P N ={p 1,p 2,…,p N−1,P N,+}, where (p_{N,+}=sum limits _{i=N}^{infty } p_{i}).
Let's discuss the opening sequence, because it's quite great.
But let's do this in sequence.
Let's see a new sequence that "turns off" the cancer gene or overrides male pattern baldness.
For those who haven't already closed their browser window in disgust (and I really don't begrudge those who have), let's scrutinise this grotesque sequence of events.
Let's start with the sequence of events and then we can go to that day.
So let's go through a sequence of pitches, a simulated at-bat.
Let's try stretching these sequences so they're each the same length.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com