Your English writing platform
Discover LudwigExact(4)
Of course, small (and sometimes less) counts in its way, too.
Motion correction by registration of PET gates becomes increasingly difficult with shorter scan times and less counts.
Applying an insufficient attenuation correction, such as the MR-based AC, leads to less counts being detected from inside the non-radioactive spheres resulting in a higher contrast recovery value than when using CT-based AC.
Among these tag profiling data one tag with the sequence CATGACAAGTTTTTGTTAATAATAAT, corresponding to the ribulose-bisphosphate carboxylase activase gene (Os11g0707000 was represented by less counts in sample d (3,291 tags) as compared to the two other replicates (11,544 and 9,234 tags).
Similar(56)
I hadn't been expecting any money from Walt, still less counting on it.
We're more or less counting down the days now that summer seems to be here.
There comes a point when you can more or less count the number of books you're going to write before you die.
In the mean time the ground-based neutron monitors showed the remarkably less count rate enhancement.
The LOS on the west side of the FOV pointed south and resulted in a less count.
These needs lead to using more satisficing (0.14**), more lexicographic (0.12**), less careful deliberation (−0.21**) and less counting of plusses and minuses (0.20**).
More enjoying food with family and friends, less counting of points behind the scenes, please.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com