Sentence examples for lengths of host from inspiring English sources

Such discrepancy could be due to the different lengths of host CNTs and the size of encapsulated cluster used in the calculations [32] compared with those of ours. Figure 3 The thermophoretic force, escaping velocity, and capture time of C 60 inside CNT.

Consequently host-parasitoid models often use a discrete time step corresponding to the common generation length of host and parasitoid.

where PL h is the payload length of host h in bytes and r h is the used data rate of host h for transmitting data packets.

So, we could write H = ATGCTAGCAGTAGACGATAGC……… n,   n > 0 and T = TGCAGTAGCAGATGAC………… m,   m > 0, where n and m are the length of host and query sequences.

For the analysis of total length and 3'-UTR length of host genes, hosts were additionally split into two groups, dependent on whether they were predicted to be targets of their intragenic miRNA.

Thus, the shorter length of host DNA segments attached to the right end of the phage genomes was presumably an artifact resulting from the shotgun fragmentation process carried out on the phage DNAs before sequencing.

At the end, we could get the result as Table 2. Host and Query sequence infections are calculated by |NBM |/ ||TL | where NBM is the total no of base pair match, which is equivalent to total number word match multiplied by word size, is divided by length of host sequence in case of virus infection, length of query sequence in case of plant infection.

Normally, the national leader would say, "I declare open the Games of Salt Lake City, celebrating the XXIII Olympiad of the modern era," perhaps using 17 words because of the length of this host name.

The time-scale of the disease process is assumed to be short compared to the life length of the host and no demographic turnover (natural birth or death) is considered.

The friendship is derived from the relations of sharing various-length common suffixes of host identifiers.

These goals are achieved by adopting a peer-tree indexing structure which is built based on the relations of sharing various-length common suffixes of host identifiers.