Sentence examples for length tap from inspiring English sources

However, the weight length (tap number) of TDes has to be the same as the length of the spreading code.

The full-length Tap coding sequence was amplified by PCR with the primers CACC-ATGGAAAAGCAGGAGGTC and TGTTGCTGGCTGTGCGTGCTT, using the cDNA generated from ovarian RNA and cloned into pENTR™/D-TOPO (Invitrogen, life technologies Grand Island, NY, USA) in accordance with the manufacturer's protocol.

North seemed certain to score but was brought crashing down by a desperate full-length tap-tackle from Strettle.

The cyclin T subunit of positive transcription elongation factor B (P-TEFb), could also be modified by the full-length TAP-ARTD10.

"I think I can rebound, and with my length offensively, tap the ball out.

Some groups have gone to greater lengths to tap these sources.

She stretches the original, often relatively long works to sometimes absurd lengths to tap into their transformative power.

Below the reservoir much of the river's length is tapped for irrigation, and a fertile, populous belt follows its course.

If this latest gambit fails, Miller may have to go to still greater lengths to tap into young men's desire for heritage, to evoke a can that never quite existed.

The adaptive filters are partitioned into K=8 sections of length 512 taps.

The CIR between node i and node j is modeled as a delay line with length L=32 taps.