Suggestions(2)
Exact(6)
Consequently host-parasitoid models often use a discrete time step corresponding to the common generation length of host and parasitoid.
where PL h is the payload length of host h in bytes and r h is the used data rate of host h for transmitting data packets.
So, we could write H = ATGCTAGCAGTAGACGATAGC……… n, n > 0 and T = TGCAGTAGCAGATGAC………… m, m > 0, where n and m are the length of host and query sequences.
Thus, the shorter length of host DNA segments attached to the right end of the phage genomes was presumably an artifact resulting from the shotgun fragmentation process carried out on the phage DNAs before sequencing.
For the analysis of total length and 3'-UTR length of host genes, hosts were additionally split into two groups, dependent on whether they were predicted to be targets of their intragenic miRNA.
At the end, we could get the result as Table 2. Host and Query sequence infections are calculated by |NBM |/ ||TL | where NBM is the total no of base pair match, which is equivalent to total number word match multiplied by word size, is divided by length of host sequence in case of virus infection, length of query sequence in case of plant infection.
Similar(54)
Such discrepancy could be due to the different lengths of host CNTs and the size of encapsulated cluster used in the calculations [32] compared with those of ours. Figure 3 The thermophoretic force, escaping velocity, and capture time of C 60 inside CNT.
Normally, the national leader would say, "I declare open the Games of Salt Lake City, celebrating the XXIII Olympiad of the modern era," perhaps using 17 words because of the length of this host name.
The time-scale of the disease process is assumed to be short compared to the life length of the host and no demographic turnover (natural birth or death) is considered.
We calculated the expected number of genes containing an intronic miRNAs in a given intron number by adding all intron lengths of introns with the respective intron number and dividing it by the summed length of all host genes' introns, thus accounting for intron frequency and length.
As part of its compromise, the legislation limited the length of time hosts could make their homes available to 90 days a year, required them to register with a public registry, and to pay the city's hotel taxes on stays booked through the Airbnb platform.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com