Sentence examples for length host from inspiring English sources

Overall, 26% of the variance in these four factors was explained by variation among collection sites, while host standard length, host sex and host species accounted for 3.6, 3.3, and 1.8% of the variance, respectively (Table 4).

Given the base pairing in the tRNA stems, one cannot exclude potential interaction with full-length host tRNAs or their fragments.

SoundCloud is aggressively competitive with its primary competitors out of the gate – it charges $55 per year for six hours of audio uploads per month and provides unlimited-length hosting for $135 per year.

Oxford won the Women's Boat Race by one-and-a-quarter lengths, hosted at Henley on 22 March 2014.

where PL h is the payload length of host h in bytes and r h is the used data rate of host h for transmitting data packets.

Consequently host-parasitoid models often use a discrete time step corresponding to the common generation length of host and parasitoid.

Several factors have been attributed to the success of mini-implant, namely, mini-implant factors (type, diameter, site of mini-implant placement and length), local host factors (occlusogingival positioning), and management factors (angle of placement, onset and method of force application, ligature wire extension, exposure of mini-implant head and oral hygiene) [2].

Nonunion was identified in five patients, who had cemented fixation and a relatively long stem length in host bone.

So, we could write H = ATGCTAGCAGTAGACGATAGC……… n,   n > 0 and T = TGCAGTAGCAGATGAC………… m,   m > 0, where n and m are the length of host and query sequences.

Thus, the shorter length of host DNA segments attached to the right end of the phage genomes was presumably an artifact resulting from the shotgun fragmentation process carried out on the phage DNAs before sequencing.

EditSeq (Lasergene software) was used to construct sequence file containing these 983 sequences and to edit the associated information for each sequence in a uniform format, for example, sequence name, sequence length, genotype, host, sample source, isolation time, and geographic area.