Exact(1)
We place the attachment points at the farthest possible distances from each other, i.e., one of them is placed at the top rightmost junction and the other one at the bottom leftmost junction of the network.
Similar(59)
Four PCR primers DupOL (ggtaatacttgcaccaacggt), DupOR (catacgaacatcgcggactcc), DupIR (cgatagacagacattggcaac) and DupIL (gagaaagattttggcgggaac)–were designed to amplify the leftmost boundary of the leftmost duplicon, the junction between these two copies, and the rightmost boundary of the rightmost duplicon.
Finally, a junction will be reported when the combination of substrings from the leftmost and rightmost ends makes up the original read.
Richard Grayson, Apache Junction, Ariz.
Junction runs until October 27.
Next look at the leftmost bin of the plot, which is pretty high too.
"Makutano Junction" is not unique.
MASOOD HAIDER Princeton Junction, N.J.
Information networks need junction points.
A junction was reached.
Greenville, Evergreen, Maycomb Junction.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com