Sentence examples for left borders from inspiring English sources

Exact(4)

RB and LB represent the right and left borders of the T-DNA.

T-DNA left borders are denoted by 'LB'LB

The bottom and left borders formed exclusion planes.

Expected PCR fragments of 1968 bp and 1202 bp for the right and left borders respectively, are indicated with an arrow.

Similar(56)

Left border: (13).

LB, left border; RB, right border; 5′ and 3′, Ac left and right-terminal inverted repeat; PR-1a, PR-1a inducible promoter; nos, nos promoter.

RB Right border, LB left border, NP nopaline synthase promoter, NPT II neomycin phosphotransferase gene, tNOS nopaline synthase terminator, 35P cauliflower mosaic virus 35S promoter, iGUS β-glucuronidase gene with an intron, HPT hygromycin phosphotransferase gene.

In a more detailed analysis, if we consider this matrix as a torus, left border group would be the continuation of the right border one, and therefore, the number of groups is reduced to two.

CaMV 35S, promoter of CaMV 35S; HptII, coding region of hygromycin phosphotransferase gene; eGFP, coding region of eGFP; NosT, terminator of nopaline synthase gene; LB left border; RB right border.

The sister of a slain Border Patrol agent said President Obama has left "border patrol agents thinly equipped," and undermanned.

The presence of the insertion was tested by PCR using a combination of three primers: Ape1L forward ("HAP7"): 5'CCCTGCCTTTCGCCGGAAAAGCGT3'; Ape1L reverse ("HAP6"): 5'TAACCTCAATCAAATCTTCAATGCATCTC3'; T-DNA left border ("TAG5"): 5'CTAG5AATAG5CTAG5CTAG5CGAC3'.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: