Sentence examples for leaves template from inspiring English sources

The effect on PCR amplification can also be observable over-amplification, i.e. amplification efficiency > 1, which could also be explained by a compound or structural conformation that leaves template copies inaccessible for the DNA polymerase in the initial PCR cycles and gradual conformation changes make more and more template copies accessible.

Figure 1 Left: template image, middle: reference image, right: registered image.

Bottom left: The five lines represent an example of the contents of the gray cubes in the top left template (with n = 800, and p = 5).

Rather than leaving templates of themselves, the Thiomargarita cells collapsed.

With interactive and clever designs that leave templates open enough to allow users to fill them with their own feeds and customized content, the publishing industry seems exciting again.

The PCR using genomic DNA of transgenic Arabidopsis leaves as template was carried out with the vector specific primers: 1304-F (5'GandCTTCCTCTATATAAG3') and 1304-R (5'GGACAACTCCATGAAAAG3').

To determine whether a heterogeneous distribution of V-sRNAs resulted from different transcription levels of viral proteins, quantitative RT-PCR was performed using total RNA from systemically infected or mock-inoculated S. lycopersicum and N. benthamiana leaves as template.

PCR amplified sequences generated with these oligonucleotide primer pairs and cDNA from pak choi leaves as template were subcloned and verified by sequence analysis.

The ORF of putative Tc-MYBPA was amplified with the Advantage cDNA PCR Kit (Clontech, Mountain View, CA, USA) using cDNA from stage A/B leaves as template with the following primer pairs: Tc-MYBPA_F (5'- GT CC ATG GGAAGGGCTCCTTGTTGTTC -3') and Tc-MYBPA_R (5'- A GCGGCCGC TCAGATCAATAATGATTCAGC -3').

A cDNA fragment corresponding to the full-length ORF of Bv_iogq (1164 bp) was obtained by PCR using attB recombination sites containing sense RS1050 (5'-attB1-ccATGGGGAGAGCACCGTGTTGCGAAAAG-3') and antisense RS1051 (5'-attB2-gTTATGAAAGTAGCCAATCAAGCATAGC-3') primers with Phusion® polymerase (New England BioLabs) on cDNAs prepared from B. vulgaris KWS2320 young leaves as template.

But by putting into motion the Chile and Singapore deals, and completing a deal with Jordan, he is leaving a template for foreign trade deals with a social conscience.