Sentence examples similar to lcs 1 from inspiring English sources

Similar(57)

In the remaining 234 LCs, 31 of 34 IOCs were successfully performed.

The majority of LCs (21, 75%) were performed within 3 months postpartum.

We formulated the broad temperature range cholesterics with the small K3 by mixing two dimeric LCs (1′,7′-bis(4-cyanobiphenyl-4′-yl)heptane (CB7CB) and 1- 4-cyanobiphenyl-4′-yl -6- 4-cyanobiphenyl-4′-yloxy)hexane (CB6OCB)), and a standard LC pentylcyanobiphenyle (5CB) (Merck).

LC 1, as he called it, was acquired by the Art Gallery of Southern Australia for $3,000.

Earlier studies revealed that interstitial DCs generated in vitro from CD34+ precursors display more potent phagocytic activity than LCs [ 1, 3].

To generate super folder GFP (sfGFP) tagged pMT-Sec24AB, pMT-Sec24AB LCS, and pMT-Sec24AB nonLCS, Sec24Ab LCS 1-4155 aa) were amplified from cDNA of Drosophila S2 cells using the forward (gatggaattccaccatgtcgacttacaat) and reverse (gtcagggccctctggagcagtggttc), and Sec24AB nonLCS (416 1184 aa) regions using forward (cagtgaattcatgctaaacgtggctca) and reverse (gtcagggccctctttttgcaacacatt) primers.

It is LC-45GX6U in the United States; LC-45G1H is its number overseas.

The Aquos Mobile LC-15L1 has three parts.

iBMM stably expressing EGFP-LC3(GFP-LC3) was a kind gift from Hardy Cornfield and grown in complete medium.

With decreasing resolution, correlations of LCA_Rho8 and LCA_D8, LCA_FD8 and LCA_D8, LCA_FD8 and LCA_Rho8 increase while those between DEMON and the other flow-routing algorithms do not change significantly.

Its new Aquos LC-15L1U is the world's first wireless flat-panel television.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: