Sentence examples for later sequencing from inspiring English sources

Later sequencing of this sample detected a substitution of reference GG alleles, at position 7518234 of chromosome 17 (exon 7 of gene TP53), by AA.

One single cDNA library was constructed using equal amounts of RNA and normalized for later sequencing.

Fragments ranging from 350 bp to 520 bp were selected for later sequencing.

A plot of per cycle error rate of these base-callers (Fig. 3) shows that all methods produce significant improvements over Bustard, especially in later sequencing cycles.

Later, sequencing (4 ) and phylogenetic (5, 6 ) studies also supported the evolution of the epizootic/epidemic serotype IAB and IC strains from enzootic ID VEEV progenitors.

The GP5+/6+ primers [ 9, 10] were modified by the addition of SeqA2 (GAATTCTCTAGATGATCAGCGGC) or Seq B2 (CGAACTTTATTCGGTCGAAAAGG) tags to their 5′ ends to simplify later sequencing.

As mentioned above, nine years later, after sequencing countless more ESTs, the rate was calculated to be 61% [ 18, 19].

On the contrary, "shit" is crucial to the punch line of a funny story Lincoln tells in a later sequence.

There followed the slightly later "Sequence" for soprano embedded in an ensemble of percussive instruments with violin and cello.

Later sequences show half the couples moving one way, while the others do something quite different.

The visual effects supervisor of the film, John Nelson, used scenes with Mr. Reed in them that had been discarded and digitally restored them for later sequences in the film.