Sentence examples for labelled control from inspiring English sources

Exact(15)

Briefly, for each tester strain equivalent amounts of Cy-3 labelled tester and Cy-5 labelled control genomic DNAs (i.e. strain NCTC 11168) with similar dye incorporation efficiencies were pooled and co-hybridized to our microarray.

Labelled experimental cDNA was used at 825 ng per microarray and labelled control genomic DNA was used at 200 ng per microarray.

When not in power, representatives from the current government labelled control orders "objectionable" and "disgusting".

Non-music control (labelled 'Control': red line), music audio-playlist groups (irrespective of rhythmic auditory stimulation) (labelled 'Playlist': green line).

Non-music control (labelled 'Control': red line), music audio-playlist without RAS (labelled 'Playlist': green line), music audio-playlist with RAS (labelled 'Playlist + RAS': purple).

Mapping of fluorescent E-selectin-specific signal in difference to the signal returned from fluorescently labelled control antibody is demonstrated in Figure 6 [57].

Show more...

Similar(45)

Control group in columns labeled "control" is composed of all non-treated control states.

The Net1 specific siRNA (HP validated 1027400), two RhoA specific siRNAs (Hs_RHOA_6 HP validated SI02654211, and Hs_RHOA_7 HP validated SI02654267), and the Alexa Fluor 488-labelled control siRNA (AATTCTCCGAACGTGTCACGT, 1022076) were purchased from Qiagen.

For each drug, four samples were run in parallel: labeled control, unlabeled control, labeled sample, and unlabeled sample.

Interestingly, outgrowths from mixtures of control and Lrp5−/− cells contained labeled (control) and unlabeled Lrp5−/− cells.

The shorter control-probes are complementary to a fluorescently labeled control sequence that is added to the hybridization solution.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: