Sentence examples for label for detection from inspiring English sources

Primers (forward primer: ACCAACTTCCTGCGCTACTGGACCCTC, reverse primer: TGATACCAAGGCTCATGGGACGCTAAAAC) contained a FAM label for detection (Eurogentec, Maastricht, The Netherlands).

Protein A peroxidase (Sigma) was used as a secondary label for detection.

After hybridization, allele-specific single-base extension provided another level of specificity and incorporated a fluorescent label for detection.

For the rapid screening of OTA in wheat and cereal samples, a direct inhibition FCIA with Mab-coated superparamagnetic beads and OTA PE, as the label for detection, was developed.

Each probe pair consisted of a common probe with a phosphate modification at the 5′ end and a unique sequence (complementary zipcode) at the 3′ end and a discriminating probe with the specific nucleotide at the 3′ end and a label for detection at the 5′ end.

QDs can also be used as electroactive labels for detection of target DNA in the electrochemical biosensors.

Li et al. [38] used silver deposition on gold labels for detection of human immunoglobulin G (IgG).

In diagnosis, they can serve as fluorescent labels for detection of biomolecules and pathogens and as contrast agents in magnetic resonance and other studies.

Previous live-cell and super-resolution microscopy studies were limited by lack of a functional fluorescent Env derivative, requiring antibody labeling for detection.

In addition, wound cryosections labeled for detection of CD31-expressing cells indicated a 2.2-fold (P < 0.0002) increased neovascularization for the treated wounds at the time of terminal biopsy.

Both also are labeled for detection by PET imaging.