Your English writing platform
Discover LudwigSuggestions(1)
Exact(5)
Primers (forward primer: ACCAACTTCCTGCGCTACTGGACCCTC, reverse primer: TGATACCAAGGCTCATGGGACGCTAAAAC) contained a FAM label for detection (Eurogentec, Maastricht, The Netherlands).
Protein A peroxidase (Sigma) was used as a secondary label for detection.
After hybridization, allele-specific single-base extension provided another level of specificity and incorporated a fluorescent label for detection.
For the rapid screening of OTA in wheat and cereal samples, a direct inhibition FCIA with Mab-coated superparamagnetic beads and OTA PE, as the label for detection, was developed.
Each probe pair consisted of a common probe with a phosphate modification at the 5′ end and a unique sequence (complementary zipcode) at the 3′ end and a discriminating probe with the specific nucleotide at the 3′ end and a label for detection at the 5′ end.
Similar(55)
QDs can also be used as electroactive labels for detection of target DNA in the electrochemical biosensors.
Li et al. [38] used silver deposition on gold labels for detection of human immunoglobulin G (IgG).
In diagnosis, they can serve as fluorescent labels for detection of biomolecules and pathogens and as contrast agents in magnetic resonance and other studies.
Previous live-cell and super-resolution microscopy studies were limited by lack of a functional fluorescent Env derivative, requiring antibody labeling for detection.
In addition, wound cryosections labeled for detection of CD31-expressing cells indicated a 2.2-fold (P < 0.0002) increased neovascularization for the treated wounds at the time of terminal biopsy.
Both also are labeled for detection by PET imaging.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com