Sentence examples for l forward from inspiring English sources

Roots of FRKC stability polynomials of degree L= MN are used to construct explicit schemes comprising L forward Euler stages with internal stability ensured through a sequencing algorithm which limits the internal amplification factors to ∼L2.

Primer sequences were as follows: cathepsin L: forward, 5'-GTGGACTGTTCTCACGCTCA-3' and reverse, 5'-TATCCACGAACCCTGTGTCA-3', DPPI: forward, 5'-TCTGTCAATGAGTGAGCTGTGTCAA-3' and reverse, 5'-TGCGCTCATGTGTGTATGGAAG-3' and b-actin: forward, 5'- AAATCTGGCACCACACCTTC -3' and reverse, 5'- AGAGGCGTACAGGGATAGCA -3'.

(L ) Forward and reverse transition rates between HS1, HS2 and NH states for Lh = 6 nt and 7 nt.

Throw in Jaime to a bench that already includes Garcia and Robbie Findley, and RSL's forward depth becomes unmatched.

When the voltage tries to pull the plate down, the plate tilts and the bottom of the L inches forward.

"Every time you hit the L-shape with a voltage, the plate collapses against the surface trying to flatten out, but it can't," he explained, "so the tip of the L scratches forward a bit".

Then, the L relays forward their normalized observations to the IECU with the aid of DS-CDMA.

The FO C (j) and FE C (l) are forward odd and even filter coefficients, respectively, where j = 1,2…9 and l = 1,2….7. Figure 2 The core filter unit showing 9-tap and 7-tap FIR filter structures with input X [ N ].

Table 3 Change amount of velocity commands for right and left wheel Command S r (t) S l (t) Forward +1 +1 Back −1 −1 Right rotation −1 +1 Left rotation +1 −1 Brake (left{ {begin{array}{*{20}l} { + 1} & {if,R_{r} omega_{r} (t) < 0} { - 1} & {if,R_{r} omega_{r} (t) > 0} end{array} } right).

In addition, a second internal L gene forward primer AP-5L1F (5'-CCCTWTKKTCTCTCATWGATACTA-3'), which would prime at APMV-5 nt 10618 10642, within the L gene, was used in conjunction with reverse primer AP-5L1R (5'- whichRTCCTCKCAwouldGWTCT-3'), which would prime at APMV-5 nt 13595 13619, within the L gene, yielding a 3002 bp length amplicon.

The model includes the binding of free receptors R to ligand L with forward rate k on and reverse-rate k off to yield inactive receptor-ligand complexes, C. Receptor-ligand complexes are reversibly activated with forward rate k fr and reverse-rate k rr to yield active complexes C a. Activated complexes are irreversibly desensitized at rate k ds.