Sentence examples for known complementary from inspiring English sources

Mn2+ doped Fe1−xMnxFe2O4 nanoparticles were synthesized using varying ratios of Mn2+:Fe2+ ions and characterized by the well known complementary techniques.

As negative control, a similarly LNA-modified scrambled oligonucleotide sequence 5′GTGTAACACGTCTATACGCCCA-3′, without known complementary sequence in the rat genome was used (Exiqon, Vedbaek, Denmark).

A probe specific for U6 snRNA (cacgaatttgcgtgtcatcctt, predicted Tm ~ 84°C, Exiqon) was used as positive control, and a 22-mer scrambled probe with a random sequence (gtgtaacacgtctatacgccca, predicted Tm ~ 87°C) having no known complementary sequence target among human transcripts performing MegaBLAST search at NCBI GenBank, was included as negative control.

The principle essentially states that there is a limit to the precision with which we can know "complementary physical variables" of a particle such as position and momentum.

This synthetic DNA created in the laboratory from mRNA is known as complementary DNA (cDNA).

There is considerable research showing that use of unconventional therapies, also known as complementary or alternative therapies, is high among adult cancer patients.

The silicon-on-insulator technology is one of a series of advances in manufacturing that have been applied to making mainstream computer chips, using a technology known as complementary metal oxide semiconductor, or C.M.O.S.

We also address the patent eligibility of synthetically created DNA known as complementary DNA (cDNA), which contains the same protein-coding information found in a segment of natural DNA but omits portions within the DNA segment that do not code for proteins.

As other papers by Professor Peri have shown, low-skilled immigrants usually fill gaps in American labor markets and generally enhance domestic business prospects rather than destroy jobs; this occurs because of an important phenomenon, the presence of what are known as "complementary" workers, namely those who add value to the work of others.

But it also permitted patents based on laboratory reconstructions of human DNA, known as complementary DNAs, or cDNAs.

But his ruling said that synthetic molecules known as complementary DNA can be patented "because it is not naturally occurring".