Almost all portable air conditioners come with a window adaptor kit that will work, however in some cases the kit is missing or not right for the window, and you will have to improvise a bit.
Neil Hampson of PwC, a consultancy, reckons Europe is paying 30-40% more than it should for military kit and missing out on exports because it cannot compete on price.
That's something that MPI should be advocating, too, no?" While missing 50 kits isn't a great loss to the business, it could be a great loss to the community, Chris says and given the festival season, it's the worst time of year to be turning people away.
The one disappointment was that the kit-house plans were missing.
While wafer-less bars have been known to pop up from time to time, a law student in the U.K. claims she suffered a "monetary and emotional" loss after buying an eight-pack of Kit Kats that were missing their crunch. .
To decrease the time and cost of manually processing pharmacy kits, Kit Check supplemented its software with RFID-outfitted stations stotions to automate the inventory process and allow pharmacists to discover what's missing from their kits in a matter of minutes.
The bad thing is that community leaders and every one else expect good services without giving us the needed tools to work (Health worker, Mbale Hospital) Shortages, especially of HIV testing kits, also constitute missed opportunities to increase male partner HIV testing and involvement in the PMTCT programme.
KNOWLEDGE ARCHIVE "Watching Auxerre v Liverpool recently, I saw that Liverpool's sponsor was missing from their kit due to it being illegal in France to advertise alcohol," said Craig Mark Scully, way back in March 2003.
Since the ATG was missing, a 5' RACE kit (Invitrogen) was used with a nested primer 5' GCCACTGACGACACAGCTTGTAA 3' that yielded the full-length clone.
You may receive a drug kit, but within the drug kit you find some items are missing.
Finding friendship — and more than a little farce — in deprivation, "Kit Kittredge" is a movie of missing men and lonely women.
