After DNA purification using the QIAamp genomic DNA micro isolation kit from human brain, 2-5 μg of genomic DNA was used to carry out the MspI (New England Biolabs) digestion at 37°C for 7 hours using 20 units of enzyme per μg of DNA.
Serum creatinine (Scr) and aspartate aminotransferase (AST) were measured spectrophotometrically using diagnostic kits purchased from Human GmbH (Wiesbaden, Germany).
The 3' UTR seed sequences of putative target genes were amplified by PCR (Phusion™ PCR kit, Finnzymes) from human melanocyte genomic DNA (Primers: KCNMA1 For – tgcggccgccttccctatatctaaacaatgcaaaatc, KCNMA1 Rev – aaccggtcacccatccaggcgaggagc, the primer set contained 5' NotI or 3' AgeI sites).
ELISA kits for Human chymase were obtained from Antibodies-Online and performed according to manufacturer's instructions.
ELISA kits for human IL-1β were purchased from Endogen (Woburn, MA, USA).
For this purpose the Enzyme Linked Inmunosorbent Assay (ELISA) kit from Invitrogen (Human IL-8 Ultrasensitive; Camarillo, CA) was used for the in vitro quantitative determination of IL-8 in human brain tissue (n = 8) and plasma (n = 20 controls and n = 24 ICH) according to manufacturer's instructions.
Cell isolation kits for human CD14 and CD4 were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany).
ELISA kits for human IL-12p70 and human IFN-γ were obtained from eBiosciences.
Probes were: VEGF-A, 700 bp cDNA (recognizing all VEGF-A mRNA splicing variants) cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA (primers VEGF-A human: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT) in PCR 2.1 vector.
CXCR4, 692 bp (recognizing two mRNA splicing variants) cloned by RT-PCR with PCR-Script Amp cloning kit (Stratagene, USA) from human total RNA (primer CXCR4 human Lp ATGCAAGGCAGTCCATGTCAT Rp TCTGTCGATGGTGATGGTGT) in pPCR-script amp SK vector.
