kindly underline

USAGE SUMMARY

The phrase "kindly underline" is correct and usable in written English.
It can be used when politely requesting someone to emphasize or highlight a specific part of a text by underlining it. Example: "In your report, kindly underline the key findings to make them stand out."

✓ Grammatically correct

Human-verified similar examples from authoritative sources

Similar Expressions

60 human-written examples

Page one featured an article on the activities of the new 28-year-old leader Kim Jong Un as he toured an amusement park: "He familiarized himself with the operation of Z-Force, Power Surge, Pirate and Volare and called at the electronic amusement hall, kindly asking which apparatus the people preferred and underlining the need to set up the chair plane…".

Vice

Page one featured an article on the activities of the new 28-year-old leader Kim Jong Un as he toured an amusement park: "He familiarised himself with the operation of Z-Force, Power Surge, Pirate and Volare and called at the electronic amusement hall, kindly asking which apparatus the people preferred and underlining the need to set up the chair plane…".

Vice

The coding region of AtHb1 (At2g16060) was PCR-amplified (F- GGATCCGAGGTTGTGAAATATTATGGAG and R- GGATCCTAGGATTTTGGAATGCACACTA BamHI sites underlined) using a full-length AtHb1 clone (kindly provided by P. Geigenberger, LMU Munich, Germany).

BMC Plant Biology

Watch kindly.

The Guardian

Kindly advise.

The New York Times

Kindly people".

The Guardian - Arts

Kindly disregard.

The New York Times

Underline "big".

The New York Times

Underline "everyone".

The New York Times - Books

Underline "technically".

The New York Times

That, kindly, describes "Tricodex".

The New Yorker

Expert writing Tips

Best practice

Use "kindly underline" when you want to make a polite yet clear request for someone to emphasize specific text. It works well in instructions or when delegating tasks.

Common error

Avoid using "kindly underline" in very casual conversations. It can sound overly formal or even sarcastic in informal settings. Opt for a simpler "please underline" instead.

Linguistic Context

The phrase "kindly underline" functions as a polite imperative, directing someone to perform the action of underlining. Ludwig AI identifies it as grammatically correct and usable in written English, suitable for making a request.

Expression frequency: Missing

Frequent in

Formal & Business

0%

News & Media

0%

Science

0%

Less common in

Formal & Business

0%

News & Media

0%

Science

0%

Ludwig's WRAP-UP

In summary, "kindly underline" is a grammatically correct phrase used as a polite imperative to request that someone underlines a specific part of a text. Ludwig AI confirms its usability, although it is considered more formal and may not be suitable for casual conversation. Common alternatives include "please underline" or similar phrases that convey the same meaning with varying degrees of formality. While "kindly underline" can be effective in instructions and professional contexts, it's important to consider the audience and situation to ensure the tone is appropriate.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

please underline

More direct and common way to ask for underlining.

would you kindly underline

Adds a layer of politeness compared to the base phrase.

kindly highlight

Uses 'highlight' instead of 'underline', implying a different form of emphasis.

underline, please

Reorders the phrase for a slightly different emphasis.

be so kind as to underline

More formal and elaborate way to request underlining.

could you underline

Polite request using 'could' instead of 'kindly'.

remember to underline

Focuses on reminding someone to underline.

make sure to underline

Emphasizes the importance of underlining.

underline this

A very direct and simple command.

it would be appreciated if you could underline

A very formal and polite request.

FAQs

How can I use "kindly underline" in a sentence?

You can use "kindly underline" when politely requesting someone to highlight a section of text. For example, "In the document, kindly underline the key points."

What is a more common alternative to "kindly underline"?

A more common alternative is "please underline", which conveys the same request with less formality.

Is "kindly underline" too formal for everyday use?

While grammatically correct, "kindly underline" can sound quite formal or even stilted in casual conversation. Consider the context and your audience when deciding whether to use it.

When is it appropriate to use "kindly underline"?

"Kindly underline" is appropriate in formal written communication, such as instructions, official correspondence, or professional reports where a polite and clear directive is needed.