Sheffield City Council is proposing to retain just 12 of the city's 28 facilities as "key" libraries.
Some devices seem to have left out key libraries that are forcing significant recoding efforts, for example.
Discretionary Spending The State Department has bought more than $70,000 worth of books authored by President Obama, sending out copies as Christmas gratuities and stocking "key libraries" around the world with Dreams From My Father more than a decade after its release.
Ensembl Zv6 (version 6-release 40, August 2006) did not contain any clones from the Danio Key (zK) library investigated in this study (233 of the 510 clones).
As two of the key fruit libraries were subtracted for actinidin, the number of ESTs in the TC is likely to be an under-representation of the actual number.
There's a puffing steam train, a charming wheeled creature known only as Cogg, a sleeping key and a library of flying books.
Data were exported and merged with the library key files (available at https://web.duke.edu/gpcr-assay/) in Microsoft Access (Microsoft Office 2011, Microsoft Corporation, Redman, WA).
At the 5' end the primers contain an adaptor sequence (forward adaptor A: CGTATCGCCTCCCTCGCGCCA, reverse adaptor B: CTATGCGCCTTGCCAGCCCGC), followed by an internal library key (TCAG).
He will assess your progress and award you with the key to the library.
