Sentence examples for junction product from inspiring English sources

The MAC junction product for IES C also appeared heterogeneous.

However, the MAC junction product for IES F was shorter in length in CU428 than in SB210 and not detectable in B2086, whereas the MAC junction product for IES G was longer in length in CU428 than in SB210 or B2086.

Now a rail junction, its products include farm machinery, electronics, and beer.

Heterogeneous boundaries for removal of IES C were evident by PCR and verified by sequencing of cloned junction amplification products.

These PCRs generated appropriately sized junction fragment products (Fig. 4B, lower panel), whose identity was confirmed by locus specific and L1 specific oligonucleotide hybridization (data not shown).

To examine the causative factors related to elevated paracellular flux and decreased TER, selected tight junction gene products were examined by Western Blot.

The nucleotide sequences of the left and right junction PCR products were determined by allowing an analysis of the imperfect 18-bp direct repeats flanking SGI1 (6, 7 ).

In the second PCR with primers P5 + P12, both located in exon exon junctions, a product with introns 2, 3, 4, 5, and 6 spliced was produced (fig. 6).

(F ) Correcting the data in (D ) with the calibration curves in (E ) and taking the ratio of internal-to-junction PCR products yields a total copy number of 5.48 ± 1.47.

Integration of the Flip construct into the NUDT9 locus was verified using the following primers, which span the Neo-Right homology Arm and the Right homology arm-genomic locus junctions in their product: Forward: ACATAGCGTTGGCTACCCGTGATA, Reverse: ACTGCTTTGAAGGCCACACATTCC.

RuvAB proteins catalyze the branch migration whereas RuvC endonuclease resolves the Holliday junction into duplex products [ 15, 16].