Sentence examples for jointly comprising from inspiring English sources

Exact(2)

Generously overlapping fragments were amplified from cox1-nad1 (using conserved nad1 primer CCTGATACTAATTCAGATTCTCCTTC), nad1-cob, cob-rrnL, and rrnL – cox1 (using conserved primer 16SARL [ 47]), jointly comprising the entire mtDNA.

Another ten families were represented by fewer than 10 species each, jointly comprising 24.7% of the fauna: Araneidae (9 species), Theridiidae and Salticidae (8), Dictynidae (7), Philodromidae (6), Clubionidae (5), and Tetragnathidae (3).

Similar(58)

Thus, normally functioning mitochondria establish MMP and a pH gradient (ΔpH), which jointly comprises Δp, the proton motive force that drives ATP synthesis.

These three ethnicities jointly comprise over 40% the global population [ 23].

Second, we included two Gulf War veteran registries established by the Departments of Veterans Affairs and Defense; while these necessarily suffer from the limitations common to registries, such as non-generalizability and absence of a control group, they jointly comprise a vast repository of standardized data that may be useful in future carefully constructed research efforts.

For LBW-scaling, we defined the common scaling factors as For all tissues except brain and skin, SFLBW provides an excellent approximation to the scaling factors SVtis in equation (12), as brain and skin jointly comprise only 8% of LBW (reference adult).

In response, President Bill Clinton announced the formation of a new federal task force--jointly comprised of the Departments of Justice and Treasury, the FBI and AFT--to oversee stronger mechanisms for the prevention and prosecution of these crimes.

The enzymes and genes involved in fine structure of amylopectin play distinct roles, but jointly comprise of the genetic dissection of rice eating quality.

Specialists in health psychology, statistics, infectious disease and public health jointly determined the measures comprising the final questionnaire, guided by the need to maintain low assessment load and parsimony to ensure good response rates.

33 34 Jointly, the MBS and PBS comprise the Australian Medicare subsidised healthcare scheme.

This was published jointly by both groups in 2014, comprising chapter 5 of the GINA report; the text was substantially revised in GINA 2015 for clarification of some of the key issues.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: