Your English writing platform
Discover LudwigSimilar(60)
Thus, normally functioning mitochondria establish MMP and a pH gradient (ΔpH), which jointly comprises Δp, the proton motive force that drives ATP synthesis.
These three ethnicities jointly comprise over 40% the global population [ 23].
Another ten families were represented by fewer than 10 species each, jointly comprising 24.7% of the fauna: Araneidae (9 species), Theridiidae and Salticidae (8), Dictynidae (7), Philodromidae (6), Clubionidae (5), and Tetragnathidae (3).
Generously overlapping fragments were amplified from cox1-nad1 (using conserved nad1 primer CCTGATACTAATTCAGATTCTCCTTC), nad1-cob, cob-rrnL, and rrnL – cox1 (using conserved primer 16SARL [ 47]), jointly comprising the entire mtDNA.
Second, we included two Gulf War veteran registries established by the Departments of Veterans Affairs and Defense; while these necessarily suffer from the limitations common to registries, such as non-generalizability and absence of a control group, they jointly comprise a vast repository of standardized data that may be useful in future carefully constructed research efforts.
For LBW-scaling, we defined the common scaling factors as For all tissues except brain and skin, SFLBW provides an excellent approximation to the scaling factors SVtis in equation (12), as brain and skin jointly comprise only 8% of LBW (reference adult).
In response, President Bill Clinton announced the formation of a new federal task force--jointly comprised of the Departments of Justice and Treasury, the FBI and AFT--to oversee stronger mechanisms for the prevention and prosecution of these crimes.
The enzymes and genes involved in fine structure of amylopectin play distinct roles, but jointly comprise of the genetic dissection of rice eating quality.
33 34 Jointly, the MBS and PBS comprise the Australian Medicare subsidised healthcare scheme.
We consider a world comprised of several regions that are jointly able to fully satisfy consumption demand with the factor endowments at hand, with each region specializing according to its comparative advantage.
We examined violent, property, and misdemeanor crimes (comprised of vandalism, prostitution, and narcotics crimes) individually and jointly to test for crime-type specific effects, while controlling for sociodemographic factors and spatio-temporal trends.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com