Sentence examples for its intended application from inspiring English sources

Altering the pH, adding enzymes, catalysts, hydrophilic or hydrophobic end groups, and adding a copolymer are all ways to adjust the degradation rate and half-life of the polymer so it better serves its intended application [ 17].

All in all, the CFIR proved to be easily applicable and highly useful for its intended application as a guide that could be used to develop assessment questions and as a framework to reveal influential factors on the guideline implementation process.

All polymers degrade to some extent, but a polymer is only considered bioabsorbable if it is absorbed relatively quickly during or immediately after its intended application [ 17].

The model must be useful for its intended application, and models of reduced complexity are attractive in many cases where time-consuming numerical procedures are required.

In the case of MMS, it had circumvented the possibility of regulatory inspection by marketing itself as a "water purifier" – a valid description of the its chemical nature, but not its intended application, leading the Irish Health Productions Regulatory Authority to describe the methods of MMS promoters as "underground and unorthodox".

We argue that the selection of an area of 500 km, albeit subjective, provides an adequate scale for its intended application in power systems, and by the patterns exhibited by the ground magnetic field measurements as will be seen below.

However, like Stevens, he acknowledges that "further investment will be needed to ensure it is robust enough for its intended applications – robust in terms of data rates, accuracy of data, range or proximity of devices".

We describe a particular approach to the so-called multiscale modelling problem spanning the range 1 1000 _and 1 107 femtosec and its intended applications to predicting structure-function relationships required for materials analysis and design.

In this note, in response to the previous note by Zinoviev and Bies [Author's Reply to: F. Farassat, Comments on the paper by Zinoviev and Bies "On acoustic radiation by a rigid object in a fluid flow", Journal of Sound and Vibration 281 (2005) 1224 1237], the present authors briefly discuss the assumptions used in the acoustic analogy and its intended applications.

In other cases, animal tests may not be necessary depending on the type of ingredient and its intended applications.

For instance the sequence TAAGACCTATGTTAGTAAAG would be represented as shown in table 2. This numerical representation removes any content bias of the original genomic sequences which may be an advantage or not depending on its intended applications [ 18, 36].