Your English writing platform
Discover LudwigExact(52)
However, Meyer believes that at this point in the IT technology cycle, startups that enable larger organisations are more likely to be a success.
And we need to focus on the IT technology instead of the facility technology.
As the needed skills change, particularly in the IT technology department, companies will need to retrain or furlough existing talent.
Over the last 15 years, the largest Internet properties have quietly led a revolution in IT technology.
The papers deal with environmental challenges and try to provide solutions using forward-looking and leading-edge IT technology.
A real IT technology hub is based around tech start-ups.
Similar(7)
The resulting effects of the introduced u-IT technology in this project can be found in four areas.
Fourth and last, introduction of the u-IT technology for the Fish farms is quite meaningful that the all the involved systems are ubiquitous.
DNA was quantified using Quant-iT technology and the Qubit quantification platform from Invitrogen.
To knock down MyoD, two different Stealth siRNA targeting two different regions of the coding sequence (MyoD-7, GACGACUUCUAUGAUGACCCGUGUU; and MyoD-8, CACUACAGUGGCGACUCAGAUGCAU) were designed with the Block-iT technology (Invitrogen) and purchased from Invitrogen Corporation.
The IT & Technology Services segment comprises of information technology and integrated engineering services.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com