Sentence examples similar to it jointly comprises from inspiring English sources

Similar(60)

Thus, normally functioning mitochondria establish MMP and a pH gradient (ΔpH), which jointly comprises Δp, the proton motive force that drives ATP synthesis.

Because these programs jointly comprise the University of Chicago Medical Center, the Hospitals Board will now be known as the University of Chicago Medical Center Board.

These three ethnicities jointly comprise over 40% the global population [ 23].

Another ten families were represented by fewer than 10 species each, jointly comprising 24.7% of the fauna: Araneidae (9 species), Theridiidae and Salticidae (8), Dictynidae (7), Philodromidae (6), Clubionidae (5), and Tetragnathidae (3).

Generously overlapping fragments were amplified from cox1-nad1 (using conserved nad1 primer CCTGATACTAATTCAGATTCTCCTTC), nad1-cob, cob-rrnL, and rrnL – cox1 (using conserved primer 16SARL [ 47]), jointly comprising the entire mtDNA.

Second, we included two Gulf War veteran registries established by the Departments of Veterans Affairs and Defense; while these necessarily suffer from the limitations common to registries, such as non-generalizability and absence of a control group, they jointly comprise a vast repository of standardized data that may be useful in future carefully constructed research efforts.

The enzymes and genes involved in fine structure of amylopectin play distinct roles, but jointly comprise of the genetic dissection of rice eating quality.

It currently comprises approximately 2,200 personnel.

"They cannot do it jointly".

Since 1990, they have owned it jointly.

Disney thrived when Mr Eisner was running it jointly with Frank Wells.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: