Your English writing platform
Discover LudwigSuggestions(5)
Exact(3)
The official said that "the fact that bin Laden's message was published with a German subtitle is underlining that we have to take it seriously".
"Mr. Ahmadinejad, by referring to many articles of the Constitution in his letter, is underlining that he represents the people, because they elected him," said Nader Karimi Joni, an Iranian journalist who has closely followed the power struggle.
"What this is about is underlining that long-term relationship with the French, focusing on border security, focusing on investment in Calais as a port as well," he said.
Similar(57)
It was underlined that day by the modest £97,250 paid for another horse portrait by Stubbs dated 1799.
(CTG 400 tracts were cloned into an SfiI site located within a linker sequence (TGGCCACGCGGGCCATTTAAATGGCCATTAGGGCC: SfiI sites are underlined) that was inserted between the termination codon of the β-galactosidase gene and the bovine growth hormone polyadenylation (BGH-PolyA) sequence.
It is underlined that DM, as it presently stands, lacks sound theoretical foundations.
It is underlined that the annual average accumulation of CO2 reaches the level of 13.41 97.03 kg carbon/m2 for 98 m2 of vertical greenery system.
It is underlined that TIM-OS photon-tetrahedron intersection style has a less computational complexity than the Plücker-coordinate scheme used in MMCM [ 2, 5].
It should be underlined that this study was not focused on technology foresight analysis (TFA).
It should be underlined that, in all cases, we did not observe graphite aggregates.
However, it should be underlined, that language should continue to receive special attention.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com