Sentence examples for is underlined that from inspiring English sources

When they read aloud from the director's copy of Peter Brook's The Empty Space with an uncomprehending shrug, the point is underlined that theatre criticism is rooted in its historical context and is inevitably subjective.

It is underlined that DM, as it presently stands, lacks sound theoretical foundations.

It is underlined that the annual average accumulation of CO2 reaches the level of 13.41 97.03 kg carbon/m2 for 98 m2 of vertical greenery system.

It is underlined that individual and community responses shape the social experience of risk and are related to both the ethnicity of the locals and the land use policy of the government.

It is underlined that sorption cooling technologies may help in solving a problem of working fluid overheating in the collector loop and in storage encountered in solar combisystems (i.e., space heating plus hot water heating).

Now, Mr Kerry and Mr Zarif have established a personal rapport, even though it is underlined that discussions focus on nuclear issues, not other major crises engulfing the Middle East.

It was underlined that day by the modest £97,250 paid for another horse portrait by Stubbs dated 1799.

(CTG 400 tracts were cloned into an SfiI site located within a linker sequence (TGGCCACGCGGGCCATTTAAATGGCCATTAGGGCC: SfiI sites are underlined) that was inserted between the termination codon of the β-galactosidase gene and the bovine growth hormone polyadenylation (BGH-PolyA) sequence.

The official said that "the fact that bin Laden's message was published with a German subtitle is underlining that we have to take it seriously".

It should be underlined that this study was not focused on technology foresight analysis (TFA).

It should be underlined that, in all cases, we did not observe graphite aggregates.