Your English writing platform
Discover LudwigSuggestions(3)
Exact(7)
I mean, today is underlined as well.... there are things... like this one, I could say I've done this more as a general one and that one more as, er.. how I was on that day".
The success of the EPT project is underlined as its philosophy was applied to the LHCb detector which is at present under construction.
That point is underlined as the referees begin their session and the first free-kick taken with the defenders standing behind the spray curls into the top corner.
Of course, it's a feminism that means more than a focus on women; it is underlined as remaking men.
Thus, the necessity and feasibility of signal normalization is underlined as the results show that an internal standard is necessary for reliable LA-ICP-MS imaging experiments.
The likely site of phosphorylation is underlined, as determined through comparison with the published phosphorylation consensus sequence for PKN1 and PKN3 substrates [ 27].
Similar(52)
An hypothetical alteration of brain 5-HT neurotransminsion in migraine patients, probably genetically determined, was repeatedly searched in the periphery (platelets, vessels, etc)., and sex and seasons were underlined as critical variables in the interpretation of diagnostic group differences [1, 10].
Domain V (747 nt) of the Drosophila 28S ribosomal RNA was produced using in vitro transcription (Fermentas, Germany) and a PCR fragment amplified with primers 5′ TAATACGACTCACTATAGGGGATATTAGACCTCGGTTTGGTATCG (T7 promoter sequence is underlined) and 5′TGTGCCATTGGTCCGTACCTGCGGG, as a template.
The title is underlined and divided across three lines.
If the text after that is seen underlined as well, then you did not type the closing tag correctly.
In the examples words that are underlined are aligned to each other and words that are strikethrough are marked as deleted.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com