Your English writing platform
Discover LudwigSuggestions(5)
Exact(9)
Clearly ({x_{n}}) is the same sequence generated by (4.1) for the map S.
As the number of source packets that can be decoded after receiving each of the three sequences is the same, sequence (1) gives the largest average packet decoding delay.
where {p n } is the same sequence as in Eq. 17 and (i) follows mainly from the observation that conditioned on (mathcal {A}), ({M_{1,p_{n}}le u_{n} }) is independent of {D 1>u n }, and (i i) and (i i i) result from the limits in Eqs. 3 and 1, respectively.
The infectious HpSVd-grapevine cDNA clone used for these experiments is the same sequence previously referred to as HpSVd-grapevine (AB219944, Table 1).
This is the same sequence as the second most common word in the bidirectional promoters.
This is the same sequence specificity as assigned to the CcrM methylase (the main cell cycle regulator).
Similar(51)
The primer pair used for real-time PCR analysis of ADAMTS5 was the same sequence reported in [12].
The T7 template sequence (5' TAATACGACTCACTATAGGCGAAAGCAGGTACTGATTGCGACAATGC 3') contains the T7 promoter region which is the first 18 nucleotides and the remaining 29 nucleotides (see the sequence underlined) are the same sequence as that of the flu template.
SabKIM1 peptide sequence was the same sequence as JNK binding KIM1 domain of mouse Sab protein.
The 37 nt ETn mini-exon was the same sequence found in the 4,5,6,7Δ35,+37ETn,8 and 6,7Δ35,+37ETn,8 products described above.
The protein sequence of the catalytic domain used was the same sequence as that of TrCel7A but truncated by the carboxy-terminal CBM and the linker sequence.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com