Sentence examples for is the same sequence from inspiring English sources
Clearly ({x_{n}}) is the same sequence generated by (4.1) for the map S.
As the number of source packets that can be decoded after receiving each of the three sequences is the same, sequence (1) gives the largest average packet decoding delay.
where {p n } is the same sequence as in Eq. 17 and (i) follows mainly from the observation that conditioned on (mathcal {A}), ({M_{1,p_{n}}le u_{n} }) is independent of {D 1>u n }, and (i i) and (i i i) result from the limits in Eqs. 3 and 1, respectively.
The infectious HpSVd-grapevine cDNA clone used for these experiments is the same sequence previously referred to as HpSVd-grapevine (AB219944, Table 1).
This is the same sequence as the second most common word in the bidirectional promoters.
This is the same sequence specificity as assigned to the CcrM methylase (the main cell cycle regulator).
The T7 template sequence (5' TAATACGACTCACTATAGGCGAAAGCAGGTACTGATTGCGACAATGC 3') contains the T7 promoter region which is the first 18 nucleotides and the remaining 29 nucleotides (see the sequence underlined) are the same sequence as that of the flu template.
The 37 nt ETn mini-exon was the same sequence found in the 4,5,6,7Δ35,+37ETn,8 and 6,7Δ35,+37ETn,8 products described above.
The protein sequence of the catalytic domain used was the same sequence as that of TrCel7A but truncated by the carboxy-terminal CBM and the linker sequence.
