Sentence examples for is on the reverse from inspiring English sources
The genes, Mup1, Mup2, Mup18, Mup24, Mup25 and Mup26 are 82 94% identical at the cDNA level and all but one (Mup2) is on the reverse strand (fig. 1, 2A).
indicates the coding sequence is on the forward sequence, while – indicates the coding sequence is on the reverse sequence.
Although the pseudogene is specifically expressed in the same tissue as TG, the RP coding frame is on the reverse strand of the TG gene.
For ANGPT4 the 5'-biotin modification is on the forward primer, whereas for PGRMC1, PRSS21 and RGS14 the 5'-biotin modification is on the reverse primer.
PRDM5 is on the reverse strand and the primer and probe sequences are as follows: F: 5′AAAACTAAACAAAAACGAAAACGCA; R: 5′GGTTTTAAATTCGGAGGTTCGC; Probe: 5′ 6FAM-CGCGCCGAAACTAAAAATACTAACG–BHQ1.
Notably, EMSA performed with hemimethylated oligonucleotides showed that the methylated C recognized by hZFP57 is on the reverse strand of the DNA target (Fig. 2B lanes 3 and 4).
As an example, the word w= CATAAT might be bound by the same transcription factor as the words CTTAAT and ATTATG, the former having one substitution, the latter being on the reverse strand.
63 ORFs and the tRNA are coded on one strand (designated forward) and 7 are on the reverse strand.
"Well, what is going on now is the reverse.
