Sentence examples for is highlighted in the list from inspiring English sources

When the user selects a particular picon, the title of its associated clip is highlighted in the list, and a short verbal description of the contents of the video clip appears in a text window in the lower left-hand corner of the screen.

This is highlighted in the insert in Fig. 4.

This is highlighted in the museum.

These are highlighted in the chapter.

Her favorite spots are highlighted in the Instagram shots below.

Automatically extracted fragments are highlighted in the sentences.

In each data set, the highest mean value is highlighted in bold Table 2 lists the number of occurrences for each gene selection method that achieved the best testing accuracy.

The miR-499 is highlighted in yellow and the miR-208 is highlighted in red.

The catalytic efficiency of the mutational variant used in the study is highlighted in bold for easy reference, and additional mutants are listed in Appendix 1 Table 1.

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * Below is a list of nations that won medals at the Games: The host nation is highlighted in blue.

The primer sequences for the cognitive genes are listed as follows (The T7 promoter sequence is highlighted in bold).: FANCG: forward (AACTACAGGCACCTTTGCACC); reverse (CTAATACGACTCACTATAGGGGGCTATTTCCACTCCTGATCTC).