Your English writing platform
Discover LudwigExact(2)
Quine's New Foundations is essentially obtained from type theory by hiding the types from the syntax.
The benefit of combined analyses is essentially obtained when the QTL is segregating in both pedigrees.
Similar(58)
However, these results were essentially obtained with verbal and visuospatial material.
The results are dual to Theorems 1 and 2 and are essentially obtained from them by using the change of variables (y_{n}=x_{-n}).
Many of the systems studied there, such as the ones in [2, 3, 5 9, 11 13, 17 20, 22 26, 28 31], were essentially obtained as some sorts of symmetrization of scalar ones, and were studied first by Papaschinopoulos and Schinas.
Estimations of DIR by head squashes stained by IFA were also performed and similar results were essentially obtained (Additional file 3: Table S1).
Plasmid encoded toxin (Pet) is a serine protease originally described in enteroaggregative Escherichia coli (EAEC) prototype strain 042 whose entire characterization was essentially obtained from studies performed with the purified toxin.
Primers: AOX-forw: CGTGAGAACAGTGCCAATGAAG AOX-rev: TCACCGATGGTCAATGCAGTAG DHAS-forw: GCAGGACGTGTACGACTTCTTC DHAS-rev: GTAGGACGCCGTAGCGTATCTC Act1-forw: GGTCATTGATAACGGATCCGG Act1-rev: CACTTGTGGTGGACAATGGATGG Cell lysates were essentially obtained as described [ 51], for subsequent AOX activity measurements as described [ 52].
It is noteworthy that the same sr-values for the test repeatability and reader repeatability were obtained: this indicates that the test is very robust and that for replicates of a sample the same binding, flow, and colour formation are essentially obtained.
The goal of this PHY layer abstraction is essentially to obtain a block error rate (BLER) for a transport block (TB) without having to carry out real signal processing.
The approach in such models is essentially to obtain an average of the two differences (28 44) and (27 33), weighted according to the sample sizes.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com