Suggestions(2)
Exact(3)
Her detailed package of measures to strengthen Britain's borders and take stronger action on exploitation is designed to underline Labour's commitment to control immigration a day after Ed Miliband "forgot" to include immigration in his 70-minute leader's speech.
It is awash with swimming pools, gyms, tennis and badminton courts, a multiplex cinema, a cricket pitch, an enormous laundry and 5,000 bicycles.Everything about the campus is designed to underline the company's claim that it is world-class, not just an Indian company that happens to have had a good run.
In milieu of this, the present review is designed to underline the plausible potential of XG or XG-based systems in drug delivery.
Similar(57)
He has worked tirelessly and his defiant body language at the Brussels summit as he "battled for Britain" was designed to underline it.
The US is seeking to distinguish India from Russia and China by stressing its history as a democracy with similar values – something Obama's presence at the Republic Day celebration was designed to underline.
Putin's recent invitation to President Assad to visit Moscow seems to have been designed to underline two things: that President Assad is indeed committed to political reform and to debunk any thought that Russia might see President Assad as somehow a discretionary, discardable component to a political solution.
He said the order was designed to underline the FARC's commitment to the peace talks with the government that have already produced a definitive ceasefire and are expected to bring a final accord by the end of the month, followed by the demobilization of the rebels.
The second experiment was designed to underline that the incorporation of several related genomes is favorable to the use of only a single reference sequence.
If patriarchy never changes, the stasis of Boland's poems might be interpreted as a desperate irony, designed to underline the helplessness that is the female poet's lot.
The pledges to put 'stability before tax cuts' and to 'love the NHS' were designed to inspire trust in the party, underlining that it had arrived at a definitively post-Thatcherite position.
For this procedure, a 2497 bp DNA segment containing the entire hlyA gene was amplified from E7946 by PCR using primers VchlySalIF 5'CAGTGTCGACTGACGAGGGTAACCCATGA and VchlyPstIR 5'CAGTCTGCAGTTTCAGGGCATGCTTCCA which were designed to contain SalI and PstI sites (underlined) for subsequent cloning.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com