Because the assembly was designed to proceed in a branched fashion, the assembly of the three independent branches is not synchronized.
Because all of the steps of EPL are designed to proceed in the presence of high salt concentrations, this approach avoids the technical hurdle caused by the decrease in the solubility of polyarginine fusion proteins when expressed in E. coli.
New primers were designed to proceed restriction endonuclease reaction (EGFR Sense: 5′CATGAGTACGTATTTTGAAACTC3′; and Anti-sense: 5′CACACACCAGTTGAGCAGGTA3′) and the PCR reaction was performed as follows: 25 ng of genomic DNA, 1X PCR buffer (Invitrogen, USA), 3 mM MgCl2 (Invitrogen, USA), 0.2 mM dNTPs, 0.5 U of GoTaq Polymerase (Promega, USA), 3 pmol of each primer up to 25 μL.
The FCC's set-top box proceeding is designed to enable consumers to watch the cable content they already pay for on the device (or app) of their choosing.
The course was designed to enable students to proceed to an economics MSc, so it had a rough equivalence to an undergraduate degree (and was accredited as such by the university regulators).
Similarly, relatively few participants accessed each coaching message (<30% for any given message), raising the question of whether decision aids should be designed to force individuals to proceed through all parts of a decision aid, or whether patients should be able to choose the information they want to view.
In 1766, Steevens published his own edition of Shakespeare's plays that was "designed to transcend Johnson's in proceeding further towards a sound text", but it lacked the benefit of Johnson's critical notes.
The course was designed to be completed in three months and students could proceed at their own pace.
When you click "Run Cleaner" a message will pop up saying "This process will permanently delete files from your system, do you want to proceed?" CCleaner is designed in such a way that by default it only targets files that the average user would not even notice are gone.
