Sentence examples for is designed to be complementary from inspiring English sources

Exact(4)

"This is designed to be complementary to cable TV".

"While Instagram.com is designed to be complementary to the mobile apps, it's important to the global conversations that happen on Instagram," an Instagram spokesperson said.

The #3 primer is designed to be complementary to a part of pTLU (nucleotide positions 471 to 492 inward from the right ITR end, see 1).

Sequencing is done by the chain termination method using primer #4 (5'GTATAATAAAATGACTTATAGG3'), which is designed to be complementary to the nucleotides 171-192 inward from each ITR end (see 1).

Similar(56)

They are designed to be complementary.

Reverse primers were designed to be complementary to the DNA sequence encoding the hexapeptide.

The startup offers two licensing options, which are designed to be complementary, including the GPLv3 and the Game Closure Free License.

The active sequences are designed to be complementary to intronic sequences of the primary transcript of the target genes.

The other three sets contain patterns of much higher complexity which are rarely present in one molecule or patterns that are designed to be complementary to each other, e.g., PAINS.

The sequence of the Im-anti-s-ODN was designed to be complementary to the HIV-1 gag-mRNA and to bind adjacent to the CpA cleavage site position.

Our approaches, validated experimentally on TRECVid data, are designed to be complementary to existing frameworks and can be regarded as possible replacements for the more computationally expensive combination strategies used elsewhere.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: