Sentence examples for is designed against from inspiring English sources

In general, secure network coding is designed against two kinds of attacks: wiretapping and Byzantine modification.

In addition, the foundation of the bollard system is designed against unnecessarily high reaction forces.

The assay is designed against the 9GL region and is capable of detecting 20 copies of a DNA standard.

The robust controller is designed against the load torque changes by using the first and second ordered derivatives of the universal learning networks (ULNs).

One is designed against the 5'UTR sequence of Syx (5'CandCCtheGCCAATAGAACATCGT3') and the other against a splicing junction at the DH domain (5'AGCTGTTTCTGTGTGGCCTGCTGA3') which leads to complete loss of normal splicing.

Thus, if an inhibitor is designed against one of these transporters, it is very likely that such an inhibitor could be active against the other enzyme.

Stealth siRNAs (Life Technologies, Paisley, UK) were designed against the 3′UTR region of human LETM1 using the BLOCK-IT™ RNAi designer (Invitrogen Life Technologies, Paisley, UK).

"When you're designed against, you know it," he says.

Not only are there pervasive misconceptions regarding dyslexia, but our academic system has been designed against their physiology.

"When you're designed against, you know it," says Ocean Howell, who teaches architectural history at the University of Oregon, speaking about anti-skateboarding designs.

Several constructs were designed against the lamin A/C target.