The primers used were as follow: IL-8 sense, 5'-AAGGAACCATCTCACTGTGTGTAAAC-3'; IL-8 antisense, 5'-ATCAGGAAGGCTGCCAAGAC-3'.
The primer sequences were as follows; IL-2: 5'-CAGTGCACCTACTTCAAGTTCTACA-3' and 5'-CCTGGTGAGTTTGGGATTCTTGTAA-3'.
The intraarticular availability of adequate levels of IL-1ra is important, as IL-1β is considered to be active at low concentrations and relatively high levels of IL-1ra are required to inhibit the effects of IL-1β [ 29].
The correlation (r) between the immunoexpression intensity of IL-2 and each receptor chain was as follows: IL-2/IL-2Rα, 0.88; IL-2/IL-2Rβ, 0.97; IL-2/IL-2Rγ, 0.85.
Piazza della Repubblica, Vignanello, +39 0761 755338, castelloruspoli.com, €10pp Isolated on an eroded spur of volcanic tufa, this improbably perched hamlet is famous as il paese che muore – the dying village.
Sensitivities of the assays were as follows: IL-4, 15 pg/ml; IL-13, 3.9 pg/ml; secretory component; 3 ng/ml.
This is intriguing as IL-34 has been associated with local inflammation in other chronic inflammatory diseases including RA and Sjögren's syndrome [ 19, 20].
The primers sequences were as follows: IL-1 β (caccttcttttccttcatctttg; gtcgttgcttgtctctccttgta), IL-6 (tgatggatccttccaaactg; gagcattggaagttggggta), TNF- α (actgaacttcggggtgattg; gcttggtggtttgctacgac), and GAPDH (gtattgggcgcctggtcacc; cgctcctggaagatggtgatgg).
The sensitivities of the test kits were as follows: IL-8: 1.5 pg/mL and TNF-α: 0.5 pg/mL.
Primer sequences were as follows: IL-6, 5′-GAGAAAGGAGACATGTAACAAGAGT-3′ (forward), 5′-GCGCAGAATGAGATGAGTTGT-3′ (reverse); GADPH, 5-TGGGGAAGGTGAAGGTCGG-3′ (forward), 5′-CTGGAAGATGGTGATGGGA- 3′ (reverse).
The gaudy, jewel-encrusted clothes he designed were derided as il stile puttana, whores' style.
