Sentence examples for is a matter of sequencing from inspiring English sources

But this is a matter of sequencing, if a ceasefire entails, as it must, a commitment to leave.

A planning problem is a matter of finding a sequence of actions that will achieve the goal, given the initial situation.

Planning the call flow is a matter of working out the sequencing and dependencies among the schemas, and, where feasible, broadening the interaction to provide the user with flexible possibilities for combining elements of their tasks in natural and productive ways.

This is probably because megablast reports non-overlapping matches, which is a matter of choice – note that the above sequence is a repeat of the 5-letter word GTGTT the query TGAATTCGGTCTTGCCTTGAACACA found a spurious perfect match on the genomic sequence NGAATTCGGTCTTGCCTTGAACACA. Except for these minor problems, all three tools reported the same hits.

Additionally, variation in the lin gene sequences is a matter of further investigation for improved degradation ability of these strains.

The role of various types of selection in protein sequence evolution is a matter of ongoing debate.

Furthermore, since TFs bind the double-stranded DNA it is a matter of interpretation which strand of the DNA sequence is annotated and stored in the database.

Thus, the spread of S. aureus ST398 among livestock is a matter of increasing concern because strains of this sequence type were able to acquire PVL genes and cause necrotizing pneumonia in a young immunocompetent patient.

However, the conclusion by the authors that "the spread of S. aureus ST398 among livestock is a matter of increasing concern because strains of this sequence type were able to acquire PVL [Panton-Valentine leukocidin] genes" is misleading.

She is a master of sequencing.

It is a matter of logistics.