IRD implied that the intervention reduced school absences by 1.8 days per year (IRD -0.15 days/child-month, 95% CI -0.19 to -0.11), while IRR suggested a 14% reduction in absences (IRR 0.86, 95% CI 0.83 to 0.90).
IRD implied that the intervention reduced ER visits by 1 visit every 2 years (IRD -0.04 visits/child-month, 95% CI: -0.05 to -0.03), while IRR suggested a 34% reduction in ER visits (IRR 0.66, 95% CI 0.59 to 0.74).
Proteins detected by the antibodies were visualized using Alexa Fluor 680 (α-rabbit) and IRD 800 labeled (α-mouse) secondary antibodies (Molecular probes and LiCor Bioscience, respectively).
Four such cysteine variants, namely IRD 9, 11 and 24 were TIs, and IRD 33 was a CI.
CI IRDs had 'Leu' at P1, except IRD 22 which had 'Pro'Pro
The universal primers M13F and M13R were labelled at the 5' end with IRD 700 and IRD 800, separately (MWG Biotech, Inc., Ebersberg, Germany).
IRD 48 (TI) had active site variation with 'Asn' being replaced with 'Asp'.
The bisulphite modified antisense primer was (IRD 700 labelled) 5′ TGGGGGAGTTTAGTAGTGTTTATTG 3′, which corresponds to position −842 to −867.
CLN3, the gene implicated in juvenile Batten disease, is also mutated in some patients with non-syndromic IRD [34].
Similarly, BBS1, implicated in Bardet Biedl syndrome, is also mutated in some patients with non-syndromic IRD [35].
