Sentence examples for introducing the target from inspiring English sources

Since protein phosphorylation does not occur in E. coli, we can use these cells as a test tube for performing in-cell biochemistry, introducing the target protein, interactor proteins and kinase activity on separately inducible plasmids (Fig. 1ab).

The tasiRNA sensor was generated by introducing the target site "A" found in ARF3 (same as site "B" found in ARF4) [20] into the 3'UTR of dsRed using the primers 5'-atggcctcctccgagaacg and 5'-taaggatccttcttgaccttgcaagaccctaatctacaggaacaggtggtggcggccctcg (stop codon of dsRed underlined, target site in bold).

The mixture was spotted on a stainless steel Opti-TOFTM 384 targets; the droplet was allowed to evaporate before introducing the target into the mass spectrometer.

Since each targeting vector generated an active PAM protein, we next attempted to generate CHO cell lines stably expressing a targeted PAM protein along with substrate by introducing the targeted PAM protein into CHO cells stably expressing Fc-GLP1-Gly.

He focused on the government's plans to scrap the child poverty target, pointing out that the bill instructs MPs to start referring to the Child Poverty Act 2010, which introduced the target, as the Life Chances Act.

In the following, we introduce the target state model, and the estimation for instantaneous target estimation, assuming an initial target position, is described.

In the first lesson, which is devised as day one in the tasks, the crux of the tasks was arranging a context to introduce the target form.

We introduce the target conductivity model (Section 4.1), describe how we generate the test data (Section 4.2) and finally present the results of our model studies (Section 4.3).

We introduce the target conductivity model (Subsection 3.1), describe how we generate the test data (Subsection 3.2) and finally present the results of our model study (Subsection 3.3).

From the policy perspective, the relevance of industries responsible for CO2 emissions is also analysed in this approach in which we introduce the target efficiency index and the control effectiveness index across industries.

This paper introduces the target equivalence range (TEQR) design, a frequentist implementation of the modified toxicity probability interval (mTPI) design, as a competitor to the standard 3 + 3 design (3 + 3).