Sentence examples for introducing restrictions from inspiring English sources

Exact(13)

British agencies say their staff have fallen under the microscope of Pakistan's spy service, the ISI, with officials visiting field offices and introducing restrictions on travel.

The move comes as the Mallorcan authorities are trying to rebrand the resort nicknamed "Shagaluf" by introducing restrictions on pub crawls and drinking in the street.

This will be achieved by introducing restrictions to the number of plies allowed in structural optimization in order to simplify pre-operations and reduce overall manufacturing investments.

UNHCR regrets that Denmark is introducing restrictions to its asylum policy rather than focusing on building and promoting a fair distribution of asylum seekers within all countries in the EU.

Seven water companies are introducing restrictions on water use following one of the driest two-year periods on record, with domestic customers facing a £1,000 fine if they use their hosepipe in defiance of the ban.

The home secretary was considering introducing restrictions amid concerns about illegal immigration from Brazil.

Show more...

Similar(47)

A linker was inserted downstream of GFP for the purpose of introducing restriction sites for the insertion of the EF1α promoter and Id1.

The ORF was amplified with a nested PCR introducing restriction sites for cloning into pET28aGST (modified pET28a vector with GST tag instead of T7 [46]).

The pGemT cloned PCR products were reamplified using two oligucleotide primer sets for introducing restriction sites for library cloning.

To amplify the 3′flanking regions of both genes, the primers P3Llod (GGCCGGCCGGGAGCTCAAGGTGTTCAAA) and P4Llod (CAAATTGTTCAAAGCGGGAAC), P3lod (GGCCGGCCGGCAGCAGCCGGTAGTATT) and P4lod (GGGTGCCAACTTATGTCACGA) were used, thereby introducing restriction site for FseI.

These regions were amplified by PCR using sequence specific oligonucleotides introducing restriction sites for XhoI and HindIII (5'), and PstI and XbaI (3'), respectively.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: