Exact(1)
The predicted promoter fragments were amplified from genomic DNA (from 2 individuals homozygous for the C or T allele of rs4391923/marker m5.3) by PCR with AmpliTaq Gold DNA polymerase (Applied Biosystems), using the forward primer 5'-CTAGACTCGAGCCTCCTGAAGATAGCTTTGC and the reverse primer 5'- CAGACAAGCTTCAGTCTCAGGAATACCTTGC (XhoI and HindIII sites introduced, underlined).
Similar(59)
Primers used, with the introduced mutations underlined, were: (Ser16→Ala) 5'- AGCGTGCCGCAGGCCAG-3'; (Ser25→Ala) 5'-GCTGATTCTCGCCCCTCGGTC-3'-CCCCCTTGCCCCTCCAAAG-3TTGCCCCTCCAAAG-3'. All mutant constructs were confirmed by DNA sequence analysis.
The concept of awareness was introduced to underline the importance of shared knowledge and enhance collaborative work.
The mutations were detected using novel restriction sites (underlined) introduced in the seed region for miRNA binding.
The primers were H1-3.3, 5'- GGATCCUTGGTCTCATACAGAACTTA, where a BamH I site (underlined) was introduced; and Pu-3.1 5'- TCTAGAUTTGCCAAACCTACAGGTGGG, where an Xba I site (underlined) was introduced.
In order to generate an RNAi-resistant Abp1 mutant several silent mutations (ATTCCGGAAAAG; mutations underlined) were introduced by PCR into the Abp1 cDNA site targeted by RNAi sequence #1.
MluI and HindIII restriction sites (underlined) were introduced through PCRs.
a) Endonuclease restriction sites introduced in primers are underlined.
Restriction sites (underlined) were introduced in the first and the last primers.
For cloning purposes, EcoRI and BamHI restriction sites were introduced into the primers (underlined), respectively.
In the oligonucleotide sequences, the introduced restriction sites are underlined and the beginning and the end of the CAT gene are in bold-italic.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com