Some modifications were introduced to the reported sequences in order to minimize difference in the annealing temperatures between the primers: forward primer, TTGATTTTAGGTTTTAGTGAGTT (sequence position −399 to −377) and reverse primer, AACTCCAAAAACCCATAACTAA (sequence position −6 to +16).
Updated at 1.08pm BST 12.41pm BST Forum bar confirmed Theresa May has confirmed that a "forum bar" will be introduced to extradition law, as reported below at 11.20am.
This came after reports of sexual abuse and leaks over the island's poor quality of health care, but before a swath of new laws were to introduced to gag workers from reporting on detainee conditions.
Pokeweed was likely intentionally introduced to China and first reported in 1935 in Zhejiang Province (Li and Xie, 2002; Xu et al., 2012).
Such is the case for two new animals introduced to the world today, as reported by BBC.
Numerous statistical tests have been introduced to detect the presence of reporting bias in conventional meta-analyses [ 5– 11].
However, in this study the performance of the MSD was found to be suboptimal even with the use of the ILS, an ordering and reporting tool introduced to make the system more efficient.
Based on a real scenario, you are introduced to an organization that reports only the net proceeds from a series of fundraising walks, instead of both the funds raised and the related costs.
The IEEE Standard 488.2 was introduced to define data formats, status reporting, controller functionality, error handling, and common commands.
LAD is an artificial intelligence technique introduced to extract information from accident reports in order to analyze machinery-related accidents in the workplace, which has not been covered in previous studies of machinery safety.
