In this work, a bioinformatics computational approach with miRNA and mRNA expression data was used to identify the putative targets of miRNAs and to construct association networks between miRNAs and mRNAs to gain some insights into the underlined molecular mechanisms of human colon cancer.
Enter Series 1 to PI into cell L5 and SPIRALLIC into L6, formatted underlined, bold, centered.
Several possible reasons for experimental failure were brought up in the first part of this paper, where various aspects that are not always taken into account were underlined (possible experimental mistakes, poor washing step, evolution of a substrate in solution, contamination of a medium by microorganisms, residual presence of precursor phases, etc).
Section II Part C (46 50) asked test takers to translate the underlined sentences into Chinese with the topic of the value of education.
The section of translation in Section II Part C which asks test takers to read a text about the value of education and translate some underlined sentences into Chinese also exhibited C-level DIF.
Table 4 shows the coding of the underlined phrases into 6 groups of phrases.
The following primers introduced the underlined mutations into pTP123 CTX-M-14 (complementary primer not shown): S237A (5′-gtgataagaccggc gccggcgactacggca-3′); R276A (5′-cgcagagagccgc gccgatgtgctggct-3′); R276N (5′-cgcagagagccgc aatgatgtgctggct-3′).
According to these results, the underlined residues, mapped into the following actin sequence : DEDETTALVCDNGSGLVKAGFAGDDAPR, could correspond to the GNK1 actin binding site.
To construct the pET21b-mEos2 plasmid, mEos2 was amplified from pRSET-mEos2 plasmid (gift from McKinney [26]) using primers GATCGCTAGCATGAGTGCGATTAAG and GATCCTCGAGTTATCGTCTGGCATTGTC, restricted with NheI and XhoI (underlined), and ligated into a similarly digested pET21b plasmid (Novagen).
For construction of pTEX6HisLiTXN3 the LiTXN3 ORF was PCR amplified with PWO polymerase (Roche) using the primers 5'-cgcgcacatATGGAGCCCAACTTCTTCAAC-3' and 5'-caccgctcgagTCACAAGCTGCGGCTGAT-3' (clamp sequences in lower case; restriction sites underlined) and cloned into the NdeI-XhoI restriction sites of pET28a (Novagen).
