Sentence examples for internal normalization control from inspiring English sources

"internal normalization control" is a correct and usable phrase in written English
You can use it when referring to a process of monitoring, adjusting, or managing the elements within a system or organization to make sure it is operating correctly and efficiently. For example, "The executive team implemented an internal normalization control process to ensure all departments were running according to their plan."

Exact(13)

Translation elongation factor 1 alpha (TEF1α) was used as the internal normalization control with the primer pair GGTGTCAGGCAGCTCATCGT/CGGTCCTCACTCCACTTGGT.

CG6213 was used as internal normalization control.

In addition, aliquots of a solution of eleven bacterial RNA transcripts, spanning a range of known frequencies, were "spiked" into each hybridization solution as an internal normalization control.

A549 or GLC-82 cells were treated with 0.45 µM 17-AAG or DMSO for 24 h and total RNAs were isolated with Trizol (Invitrogen, Karlsruhe, Germany), 18S rRNA gene was used as the internal normalization control.

As internal normalization control, a PCR using methylation insensitive primers (for gnDNA: forward, 5'-CTCCAACTCAGGGCCTACAC; reverse, 5'-CCAGGCTTTTGTGGCCTAT in combination with SYBR green; for pOctTK plasmid: forward, 5'-ACTGCATCTCCCTTTCCTTGT; reverse, 5'-GCCCCCTGCAAGTCTTTT in combination with Roche UPL probe #137) was performed (data not shown).

GAPC was used as the internal normalization control.

Show more...

Similar(47)

The amounts of the target gene expressed in a sample were normalized to the amounts of internal normalization controls, including the endogenous 'house-keeping' 18S rRNA and GAPDH (glyceraldehyde 3-phosphate dehydrogenase) transcripts.

The amounts of the target gene expressed in a sample were normalized to the amounts of internal normalization controls, including the endogenous "housekeeping" 18S rRNA and glyceraldehyde-3-phosphate dehydrogenase transcripts.

Gapdh or L19 were used as the internal normalization controls.

U6 snoRNA or GAPDH mRNA levels were used as internal normalization controls.

HCT116 protein extracts used as internal normalization controls in each blot were all from the same batch.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: